DB Dot blot



Anti-5-hydroxymethylcytosine (5-hmC) antibody [4D9] - ab178771 from Abcam

Prices $376.00
Sizes 50 µg
Host Mouse
Clonality Monoclonal
Clone 4D9
Direct ELISA performed with serial dilutions of ab178771 against 5-Hydroxymethylcytosine in antigen coated wells. Antigen used: BSA coupled to 5-Hydroxymethylcytosine base. Estimated titer: 0.05µg/ml.

Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] - ab106918 from Abcam

Prices $385.00
Sizes 100 µg
Host Rat
Clonality Monoclonal
Clone AB3/63.3
Dot blot assay shows that ab106918 specifically recognized 5-hydroxymethyl Cytidine (hmC). Indicated amounts of hmC, methyl Cytidine (mC) and Cytidine (C) were spotted onto a membrane that was then incubated with ab106918. hmC, mC and C were generated in the following way: M13mp18 DNA had been amplified using primers F and R; F: atttccatgagcgtttttcc R: gcaaggcaaagaattagcaa. A 200 uM dNTP end concentration was used with 1. A,G,C,T and 2. A,G,hmC,T; where C had been replaced with HmdCTP. DNA was in vitro methylated with SssI and SAM, and 2ul of pmol of each base was denatured at 95C for 5 min and spotted and dried onto the membrane. The dot blot membrane was blocked with 10%skimmed milk + 1%BSA blocking overnight and then incubated with ab106918 at 1:500 in blocking solution. A goat anti rat HRP secondary antibody was used for ECL detection. This image is from an anonymous collaborator.

Anti-5-hydroxymethylcytosine (5-hmC) antibody [GT513] - ab184148 from Abcam

Prices $368.00
Sizes 100 µl
Host Mouse
Clonality Monoclonal
Clone GT513
Dotblot analysis of ab184148 with PCR controls.DNA samples (50 to 2 ng as indicated) were spotted onto the positively charged nylon membrane and blotted with ab184148 at a dilution of 1/500.1: Unmethylated DNA2: DNA containing 5-methylcytosine3: DNA containing C3orf37

Anti-6X His tag® antibody [4D11] - ab5000 from Abcam

Prices $400.00
Sizes 100 µg
Host Mouse
Clonality Monoclonal
Clone 4D11
All lanes : Anti-6X His tag® antibody [4D11] (ab5000) at 1/2000 dilutionLane 1 : Lysates prepared from HEK-293 cellsLane 2 : Lysates prepared from HEK-293 cells transfected with Beta3-His (CACNB3)SecondaryHRP-conjugated goat anit-mouse IgG polyclonal at 1/5000 dilutionThis image is courtesy of an Abreview submitted by Dr Vladimir MilenkovicSee Abreview

Anti-6X His tag® antibody [HIS.H8] - ab18184 from Abcam

Prices $401.00
Sizes 100 µg
Host Mouse
Clonality Monoclonal
Clone HIS.H8
Immunofluorescence (red) with ab18184 on His-tag fusion protein in 293 cells.Left hand panel: untransfected controlRight hand panel: transfected.Counterstained with DAPI (blue).

Anti-6X His tag® antibody [HIS-1] - ab49936 from Abcam

Prices $372.00
Sizes 100 µl
Host Mouse
Clonality Monoclonal
Clone HIS-1

Anti-6X His tag® antibody [HIS-1] (Alkaline Phosphatase) - ab49746 from Abcam

Prices $372.00
Sizes 100 µl
Host Mouse
Clonality Monoclonal
Clone HIS-1

Anti-A549 antibody - ab25816 from Abcam

Prices $370.00
Sizes 100 µg
Host Goat
Clonality Polyclonal

Anti-ABCF1 antibody [ABC5H06] - ab50976 from Abcam

Prices $370.00
Sizes 100 µg
Host Mouse
Clonality Monoclonal
Clone ABC5H06
Anti-ABCF1 antibody [ABC5H06] (ab50976) at 1/100 dilution + RIPA lysate of HeLa cells at 500 µgSecondaryAnti-mouse IgG at 1/1000 dilutiondeveloped using the ECL technique

Anti-ABCF2 antibody [2001C1] - ab50807 from Abcam

Prices $370.00
Sizes 100 µg
Host Mouse
Clonality Monoclonal
Clone 2001C1
Anti-ABCF2 antibody [2001C1] (ab50807) + Recombinant ABCF2 fragment

Anti-Acetate Kinase antibody - ab182938 from Abcam

Prices $370.00
Sizes 10 mg
Host Rabbit
Clonality Polyclonal

Anti-Acetate Kinase antibody - BSA and Azide free (Biotin) - ab182952 from Abcam

Prices $370.00
Sizes 1 ml
Host Rabbit
Clonality Polyclonal

Anti-Acetylcholinesterase antibody (Biotin) - ab34533 from Abcam

Prices $370.00
Sizes 100 µg
Host Goat
Clonality Polyclonal

Anti-ACTH (phospho S168) antibody - ab110880 from Abcam

Prices $370.00
Sizes 400 µl
Host Rabbit
Clonality Polyclonal
Dot Blot analysis of ab110880 at 0.5ug per ml on nitrocellulose membrane. 50ng of Phospho-peptide or Non Phospho-peptide per dot were adsorbed.

Anti-ACTH antibody - ab8906 from Abcam

Prices $370.00
Sizes 100 µl
Host Rabbit
Clonality Polyclonal

Anti-Actin antibody [AC-40] - ab11003 from Abcam

Prices $401.00
Sizes 100 µl
Host Mouse
Clonality Monoclonal
Clone AC-40
ab11003 staining Actin in Human SW480 cells by Immunocytochemistry/ Immunofluorescence. The cells were formaldehyde fixed and then blocked using 10% serum for 1 hour at 25°C. Samples were then incubated with primary antibody at 1/50 for 2 hours at 25°C. The secondary antibody used was a goat anti-mouse IgG conjugated to Alexa Fluor® 568 (red) used at a 1/100 dilution.See Abreview

Anti-AcV5 tag antibody [AcV5] - ab49581 from Abcam

Prices $406.00
Sizes 100 µl
Host Mouse
Clonality Monoclonal
Clone AcV5

Anti-ADA antibody - ab34639 from Abcam

Prices $359.00
Sizes 10 mg
Host Rabbit
Clonality Polyclonal

Anti-ADA antibody (Biotin) - ab34677 from Abcam

Prices $372.00
Sizes 100 µg
Host Rabbit
Clonality Polyclonal

Anti-ADA antibody (HRP) - ab34651 from Abcam

Prices $370.00
Sizes 100 µg
Host Rabbit
Clonality Polyclonal

Anti-ADNP antibody [102C1a] - ab54402 from Abcam

Prices $370.00
Sizes 100 µg
Host Mouse
Clonality Monoclonal
Clone 102C1a
Anti-ADNP antibody [102C1a] (ab54402) + immunised recombinant protein

Anti-AEBP2 antibody [2012C4a] - ab74517 from Abcam

Prices $370.00
Sizes 100 µg
Host Mouse
Clonality Monoclonal
Clone 2012C4a
Anti-AEBP2 antibody [2012C4a] (ab74517) + Immunising recombinant protein

Anti-AKAP8 antibody [2015C1] - ab58620 from Abcam

Prices $370.00
Sizes 100 µg
Host Mouse
Clonality Monoclonal
Clone 2015C1
Anti-AKAP8 antibody [2015C1] (ab58620) + immunogen (recombinant fragment)

Anti-AKT1 (phospho S473) antibody - ab66138 from Abcam

Prices $403.00
Sizes 200 µl
Host Rabbit
Clonality Polyclonal
All lanes : Anti-AKT1 (phospho S473) antibody (ab66138) at 1/1000 dilutionLane 1 : Whole cell lysate derived from PDGF stimulated 3T3Lane 2 : Whole cell lysate derived from PDGF stimulated 3T3 with immunising peptideLysates/proteins at 10 µg per lane.

Anti-AKT1 (phospho T308) antibody - ab66134 from Abcam

Prices $394.00
Sizes 200 µl
Host Rabbit
Clonality Polyclonal
All lanes : Anti-AKT1 (phospho T308) antibody (ab66134) at 1/1000 dilutionLane 1 : PDGF stimulated 3T3cellsLane 2 : PDGF stimulated 3T3 cells with Band abolished by pre-incubation with immunizing peptide.
Search more