MeDIP Methylated DNA immunoprecipitation



Anti-5-hydroxymethylcytosine (5-hmC) antibody [4D9] - ab178771 from Abcam

Prices $376.00
Sizes 50 µg
Host Mouse
Clonality Monoclonal
Clone 4D9
Direct ELISA performed with serial dilutions of ab178771 against 5-Hydroxymethylcytosine in antigen coated wells. Antigen used: BSA coupled to 5-Hydroxymethylcytosine base. Estimated titer: 0.05µg/ml.

Anti-5-hydroxymethylcytosine (5-hmC) antibody [AB3/63.3] - ab106918 from Abcam

Prices $385.00
Sizes 100 µg
Host Rat
Clonality Monoclonal
Clone AB3/63.3
Dot blot assay shows that ab106918 specifically recognized 5-hydroxymethyl Cytidine (hmC). Indicated amounts of hmC, methyl Cytidine (mC) and Cytidine (C) were spotted onto a membrane that was then incubated with ab106918. hmC, mC and C were generated in the following way: M13mp18 DNA had been amplified using primers F and R; F: atttccatgagcgtttttcc R: gcaaggcaaagaattagcaa. A 200 uM dNTP end concentration was used with 1. A,G,C,T and 2. A,G,hmC,T; where C had been replaced with HmdCTP. DNA was in vitro methylated with SssI and SAM, and 2ul of pmol of each base was denatured at 95C for 5 min and spotted and dried onto the membrane. The dot blot membrane was blocked with 10%skimmed milk + 1%BSA blocking overnight and then incubated with ab106918 at 1:500 in blocking solution. A goat anti rat HRP secondary antibody was used for ECL detection. This image is from an anonymous collaborator.

Anti-5-methylcytosine (5-mC) antibody [33D3] - ab10805 from Abcam

Prices $397.00
Sizes 50 µg
Host Mouse
Clonality Monoclonal
Clone 33D3
ab10805 staining 5-Methyl Cytidine in pig embryo (15 to 17 days) tissue section by Immunohistochemistry (Formalin/PFA-fixed paraffin-embedded sections). Tissue underwent fixation in paraformaldehyde, heat mediated antigen retrieval in Tris-EDTA buffer, permeabilization in Triton X-100 and blocking in 2% BSA for 10 minutes at 25°C. The primary antibody was diluted, 1/100 (PBS + 2% BSA) and incubated with sample for 1 hour at 25°C. An Alexa Fluor® 488 conjugated donkey polyclonal to mouse at 1/250 dilution, was used as secondary.See Abreview

Imprint® Monoclonal Anti-5-methylcytosine (33D3) antibody produced in mouse - SAB4800001 from Sigma-Aldrich

Prices $544.00
Sizes 100 µg
Host Mouse
Clonality Monoclonal
Clone 33D3
<B>Immunofluorescence</B><BR/>Anti-5-methylcytosine: <B>Cat. No. SAB4800001</B>: HeLa cells were stained with 5-methylcytosine Mouse monoclonal antibody, 33D3 clone, and nuclei were counterstained with DAPI. Cells were methanol fixed for 10 minutes at -20 °C. Cells were re-hydrated in PBS and then treated with 2N HCl for 30 minutes at 37 °C. After two washes in borate buffer, cells were blocked with 1% BSA containing PBS.<BR/><B>Figure A</B>: Cells were immunofluorescent labeled with the antibody diluted 1:100 in the blocking solution and incubated with the cells during one hour at room temperature in the dark, followed by a Goat Anti-Mouse FITC conjugated antibody. Scale bar is 75 μm.<BR/><B>Figure B</B>: Enlarged picture corresponding to a region from the left panel, as indicated in <B>Figure A</B>.<BR/><B>Figure C</B>: Nuclei were DAPI stained to specifically label the DNA. The region shown is the same as seen in <B>Figure B</B>.

Imprint® Anti-5-hydroxymethylcytosine antibody produced in rabbit - SAB4800051 from Sigma-Aldrich

Prices $450.00
Sizes 100 µl
Host Rabbit
Clonality Polyclonal
<B>Immunoblotting</B><BR/>Anti-5-hydroxymethylcytosine: <B>Cat. No. SAB4800051</B>: Dot blot analysis was performed, to determine the antibody specificity, using C, mC and hmC containing PCR products. 100 to 4 ng, equivalent of 5 to 0.2 pmol of C-bases, were spotted on a membrane, Amersham Hybond-N+. The membrane was incubated with the Rabbit 5-hydroxymethylcytosine polyclonal antibody (dilution 1:200). The membranes were exposed for 30 seconds.

Imprint® Monoclonal Anti-5-hydroxymethylcytosine antibody produced in mouse - SAB4800049 from Sigma-Aldrich

Prices $525.00
Sizes 50 µg
Host Mouse
<B>Immunoblotting</B><BR/>Anti-5-hydroxymethylcytosine : <B>Cat. No. SAB4800049</B>: Dot blot analysis of the 5-hydroxymethylcytosine mouse monoclonal antibody with cytosine (C), methylcytosine (mC) and hydroxymethylcytosine (hmC) PCR controls. 200 to 2 ng (equivalent of 10 to 0.1 pmol of C-base) of hmC (1), mC (2) and C (3) PCR controls were spotted on a membrane. The membrane was incubated with 2 μg/mL (1:500 dilution) of the antibody. The membrane was exposed for 30 seconds.

Imprint® Monoclonal Anti-5-hydroxymethylcytosine antibody produced in rat - SAB4800002 from Sigma-Aldrich

Prices $885.00
Sizes 100 µg
Host Rat
<B>Immunoblotting</B><BR/>Anti-5-hydroxymethylcytosine: <B>Cat. No. SAB4800002</B>: Dot blot analysis of 5-hydroxymethylcytosine and 5-methylcytosine monoclonal antibodies with cytosine, C, methylcytosine, mC, and hydroxymethylcytosine, hmC, PCR controls.<BR/><B>Figure A</B>: Approximately 200 ng, equivalent 10 pmol of C-base, of hmC, 1, mC, 2, and C, 3, PCR controls were spotted on a membrane. The membrane was incubated with 4 μg/mL 5-hmC rat monoclonal antibody, followed by an HRP conjugated secondary antibody. The membrane was exposed for 30 seconds.<BR/><B>Figure B</B>: Incubation of the same membrane with the 5-methylcytosine Mouse monoclonal antibody, <B>Cat. No. SAB4800001</B>, diluted 1:250. The membrane was not stripped after the 5-hmC incubation. The left spot represents the remaining hmC signal, which confirms that an equal amount of mC bases was spotted at position 2.

5-Methylcytosine / 5-mC antibody [EP4694] - GTX63441 from GeneTex

Host Rabbit
Clonality Monoclonal
Clone EP4694
Anti-5-Methylcytosine / 5-mC antibody [EP4694] used in Methylated DNA Immunoprecipitation. GTX63441

Anti-5-Methylcytosine Antibody, clone EP4694, Rabbit Monoclonal - MABE527 from EMD Millipore

Prices $305.00
Sizes 100 µl
Host Rabbit
Clonality Monoclonal
Clone EP4694

Anti-5-methylcytosine Antibody, clone 33D3 - MABE146 from EMD Millipore

Prices $367.00
Sizes 100 µg
Host Mouse
Clonality Monoclonal
Clone 33D3

Anti-5-hydroxymethylcytosine (5hmC) Antibody, clone HMC 31 - MABE251 from EMD Millipore

Prices $319.00
Sizes 100 µg
Host Mouse
Clonality Monoclonal
Clone HMC 31
Dot Blotting (Specificity Analysis): <br />Representative lot data. <br />Unmodified and various modified cytosine DNA were probed with Cat. No. MABE251, Anti-5-hydroxymethylcytosine (5hmC), clone HMC 31 (0.1 µg/mL). <br />Proteins were visualized using a Goat Anti-Mouse IgG secondary antibody conjugated to HRP and a chemiluminesence detection system.

Anti-methylcytosine Antibody, clone 87G31 - MABE345 from EMD Millipore

Prices $309.00
Sizes 100 µg
Host Mouse
Clonality Monoclonal
Clone 87G31

33D3 5-mC monoclonal antibody - Premium - C15200081-10 (MAb-081-010) from Diagenode

Host Mouse
Clonality Monoclonal

5-Hydroxymethylcytosine / 5-hmC antibody [GT513] - GTX629701 from GeneTex

Prices $299.00
Sizes 100 μl
Anti-5-Hydroxymethylcytosine / 5-hmC antibody [GT513] used in Methylated DNA Immunoprecipitation. GTX629701

5-HydroxymethylCytosine - MBS270123 from MyBioSource

Prices $360.00
Sizes 100 µl
Host Mouse
Clonality Monoclonal
Clone GT513
Dotblot analysis of anti- 5-Hydroxymethylcytosine / 5-hmC antibody [GT513] with DNA samples DNA samples (50 to 500 ng as indicated) were spotted onto positively charged nylon membrane and blotted with 5-Hydroxymethylcytosine / 5-hmC antibody [GT513] at a dilution of 1:500. A: Genomic DNA derived from 293T cells. B: Genomic DNA derived from human TET-1 transfected 293T cells.

5-Methylcytidine Antibody (33D3) [Alexa Fluor (R) 488] - NB100-65014AF488 from Novus Biologicals

Prices $349.00
Sizes 50 tests
Host Mouse
Clonality Monoclonal
Clone 33D3

5-Methylcytidine Antibody (33D3) [PE] - NB100-65014PE from Novus Biologicals

Prices $369.00
Sizes 50 tests
Host Mouse
Clonality Monoclonal
Clone 33D3

5-Methylcytidine Antibody (33D3) [DyLight 405] - NB100-65014V from Novus Biologicals

Prices $349.00
Sizes 50 tests
Host Mouse
Clonality Monoclonal
Clone 33D3

5-Methylcytidine Antibody (33D3) [7C] - NB100-65014V2 from Novus Biologicals

Prices $349.00
Sizes 50 tests
Host Mouse
Clonality Monoclonal
Clone 33D3

5-Methylcytidine Antibody (33D3) [DyLight 350] - NB100-65014UV from Novus Biologicals

Prices $349.00
Sizes 50 tests
Host Mouse
Clonality Monoclonal
Clone 33D3

5-Methylcytidine Antibody (33D3) [Alexa Fluor (R) 700] - NB100-65014AF700 from Novus Biologicals

Prices $349.00
Sizes 50 tests
Host Mouse
Clonality Monoclonal
Clone 33D3

5-Methylcytidine Antibody (33D3) [Alexa Fluor (R) 647] - NB100-65014AF647 from Novus Biologicals

Prices $349.00
Sizes 50 tests
Host Mouse
Clonality Monoclonal
Clone 33D3

5-Methylcytidine Antibody (33D3) [Alexa Fluor (R) 405] - NB100-65014AF405 from Novus Biologicals

Prices $349.00
Sizes 50 tests
Host Mouse
Clonality Monoclonal
Clone 33D3

5-Methylcytidine Antibody (33D3) [PerCP] - NB100-65014PCP from Novus Biologicals

Prices $369.00
Sizes 50 tests
Host Mouse
Clonality Monoclonal
Clone 33D3

5-Methylcytidine Antibody (33D3) [DyLight 755] - NB100-65014IR from Novus Biologicals

Prices $349.00
Sizes 50 tests
Host Mouse
Clonality Monoclonal
Clone 33D3
Search more